, 2005; Vu-Khac et al., 2007). New primers for STb (F: GGACCTATGTTCGTTTTTTCTAT, R: ATCTCTAACCCCTAAAAAACCT) were check details designed with an annealing temperature of 52 °C and a product size of 132 bp. The DNA sequences obtained were compared at the GenBank web site using blast (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Clinical isolates confirmed to

be carrying these VGs by DNA sequencing were used as positive controls. PFGE was used to analyze the genomic relatedness among E. coli isolates from diseased piglets. PFGE of chromosomal DNA digested with the restriction enzyme XbaI was carried out according to a standard protocol using a CHEF-MAPPER System (Bio-Rad Laboratories, Hercules, CA). The gels were run at 6.0 V cm−1 with an angle of 120° at 14 °C for 22 h and the results were interpreted according to the criteria of Tenover et al. (1995). Salmonella ser. Braenderup H9812 standards served as size markers. To facilitate our analysis, we grouped the isolates with intermediate susceptibility with the resistant strains. Two-tailed Fisher’s

exact tests (sas, version 8.2; SAS Institute Inc., Cary, NC) were used to analyze the data. P-values of <0.05 were considered significant associations, and in such cases, odds ratios and their 95% confidence intervals (CI) were calculated. According to genotyping, the 167 isolates from diseased piglets were classified as 39 enterotoxigenic E. coli (ETEC) isolates (isolates carrying Apoptosis inhibitor at least one enterotoxin gene and F4 or F18) and 128 non-ETEC isolates (isolates lacking a combination of enterotoxin and fimbrial genes). The frequency of resistance to 12 antimicrobial agents for the whole set of isolates and for the subsets of epidemiologically unrelated isolates is presented in Table 1. Compared with non-ETEC isolates, except for ceftriaxone, kanamycin, streptomycin, and doxycycline, the frequency of resistance to the antimicrobial agents was higher or similar in ETEC isolates. Thirty-one (20%) and 23 (13%) isolates from diseased pigs presented a reduced susceptibility to ceftriaxone and doxycycline, respectively. Resistance to sulfamethoxazole (95%) and

tetracycline (94%) was found to be the most prevalent in epidemiologically unrelated isolates. The majority of isolates from diseased Pembrolizumab mouse pigs were resistant to chloramphenicol (89%) and streptomycin (84%). Resistance to ciprofloxacin was found in 109 strains (72%). The rates of resistance to apramycin, ceftiofur, and florfenicol ranged from 30% to 49%, whereas 25% of the isolates were resistant to amikacin. With regard to multidrug resistance profiles, all isolates were resistant to more than two of the 12 antimicrobials tested, 89% were resistant to more than five, 70% were resistant to more than seven, and 1% were resistant to 12. The most frequently observed pattern of multiresistance in all isolates was sulfamethoxazole/tetracycline/chloramphenicol/streptomycin. According to multi-PCR-based phylotyping, the majority of E.