Reelin Western blots were performed as described by Krstic et al. (2012b). RNA was extracted using a GenElute Mammalian Total RNA Miniprep Selleck ALK inhibitor Kit (Sigma, St Louis, MO, USA) according to the manufacturer’s instructions. Total RNA was quantified by absorbance spectroscopy and RNA integrity and quality was assessed by 1.0%

agarose gel electrophoresis. Total RNA (1 μg) was transcribed to cDNA with SuperScript II (Invitrogen, Carlsbad, CA, USA) using random hexamer primers according to the manufacturer’s instructions. For quantitative real-time PCR (qPCR), 20 ng of cDNA was used, and single transcript levels of genes were detected with the HOT FIREPol EvaGreen qPCR Mix (Solis BioDyne, Tartu, Estonia) and an AB7900 thermocycler. Primers used for detection of synaptic

transcripts were as follows: β-actin, AGTGTGACGTTG ACATCCGTA (sense), GCCAGAGCAGTAATCTCCTTCT (antisense); Gephn, GGCGACCGAGGGAATGAT (sense), CCACCCAACAAAGAAGGATCTT (antisense); Gabra1, GGTTGACCGTGAGAGCTGAA (sense), CTACAACCACTGAACGGGCT Selleck MLN0128 (antisense); Gabra2, CAGTGGCCCATAACATGACAAT (sense), GGACATTCGGCTTGGACTGT (antisense); CamKIIa, CCCCTTTCGCCTACATGTGA (sense), GGCTACAGTGGAGCGGCTTA (antisense). Data were analysed using the comparative CT method (Schmittgen & Livak, 2008). Images from immunoperoxidase staining were acquired with a color digital camera using either bright- or dark-field illumination (Zeiss Axioskop microscope, Jena, Germany) and assembled with Photoshop. A sharpening filter was applied to all images. Immunofluorescence images were captured by laser scanning confocal microscopy, using a 40 × lens, NA 1.4, 1024 × 1024 pixels (Zeiss LSM Nabilone 700). Final illustrations were prepared from the maximal intensity projection of stacks of images spaced at 0.5 μm. Images were

background-subtracted and filtered with a Gaussian filter, but no change in brightness and contrast was applied. In this protocol, ACSF-perfused living tissue is fixed by immersion in aldehyde solution (4% paraformaldehyde dissolved in sodium phosphate buffer). We systematically tested the duration of fixation to determine the time required for entire blocks (hemi-brain cut sagitally along the midline or coronal block containing either the entire hippocampal formation or the entire cerebellum) to be fixed while preserving optimal antigenicity of proteins of interest. For such tissue blocks (up to 2–3 cm3), we saw no difference in staining quality/intensity at different tissue depths, suggesting that a homogeneous fixation was achieved even after a short fixation (60–90 min). However, fixation of entire brains was not appropriate, possibly because fixative did not penetrate through the ventricular system. No tissue block was fixed longer than 6 h, prior to washing and cryoprotection.