The number of alleles and haploid genetic
diversity per locus ranged from 2 to 30, and 0.204 to 0.881, respectively (Table 1). In the clone-corrected data set, genotypic linkage disequilibrium was not detected by pairwise comparison of loci across the overall isolates (P > 0.01). Table 1 Characteristics of seven microsatellite markers developed from ‘Candidatus Liberibacter asiaticus’ SSR Markers Primer sequences (5′—–3′) Repeats Location in genome ORF T a (°C) Size range (bp) No. of alleles H LasSSR-A-f LasSSR-A-r FAM-CGCCTACAGGAATTTCGTTACG TCTCATCTTGTTGCTTCGTTTATCC (TATTCTG)8 255477-255753 adenosine deaminases 50°C 241-434 30 0.881 LasSSR-B-f LasSSR-B-r VIC-ATCGCCTATAAATCCCTTTACTGATATGTTTCC TGGTAACGGAAGTGATAATAACTACAGCAATAAG (TTTAA)6 669257-669458 hypothetical protein 60°C 196-206 3 0.216 LasSSR-C-f LasSSR-C-r VIC-CGATTGTTGATGAATTACC MK-8931 solubility dmso GAATAGAAGAACCCTAAGC (CAGT)8 666722-666947 phosphohydrolases 50°C 208-254 15 0.613 LasSSR-D-f LasSSR-D-r NED-CGGTGTCGGTATCGGTATCATTC
MLN2238 ic50 CGAAGAAGAGACGGAGGTTAAGC (TTC)5 377678-377850 hypothetical protein 55°C 158-174 3 0.391 LasSSR-E-f LasSSR-E-r NED-GATCAGTAGTCTATCACCAC TACTGGAAACAAATGGAATAC (CTTGTGT)5 354424-354613 transcriptional regulator 50°C 173-290 17 0.587 LasSSR-F-f LasSSR-F-r FAM-TCGTCTTATCGTATATCACTCC TTCACTATTAAAGGATCAAGGC (TTTACATC)3 520542-520307 repair ATPase 52°C 227-235 2 0.204 LasSSR-G-f LasSSR-G-r FAM-CGGGAGAAATTAAAGATGATGG CGCTGTTAATACATACTTACGC (TTGTTGGA)2 998251-998403 hypothetical protein 53°C 139-152 2 0.204 T a, annealing temperature of the primer pairs; H, Haploid genetic diversity Each forward primer was labeled with FAM, NED, VIC fluorescent dyes at 5′, respectively Table 2 Descriptive statistics and genetic diversity of ‘Candidatus Liberibacter asiaticus’ isolates across
seven microsatellite very loci in the samples obtained from nine different countries from Asia, North (Florida, USA) and South Americas (São Paulo, Brazil) Country Location ID Location Information Total number of individuals Number of individuals in clone corrected data Alleles per locus Haploid genetic diversity EX 527 cost Brazil BRA São Paulo 22 14 2.7 0.313 USA FL-A Charlotte County, Florida 5 4 1.6 0.161 FL-B Collier County, Florida 46 11 2.1 0.234 FL-C DeSoto County, Florida 30 5 1.7 0.194 FL-D Hardee County, Florida 8 5 1.7 0.160 FL-E Hendry County, Florida 13 5 1.6 0.171 FL-F Highlands County, Florida 19 6 1.7 0.119 FL-G Indian River, County, Florida 23 7 1.9 0.175 FL-H Martin County, Florida 10 7 1.9 0.175 FL-I Okechobee County, Florida 4 2 1.3 0.143 FL-J Polk County, Florida 6 4 2.0 0.304 FL-K St. Lucie County, Florida 6 4 1.4 0.179 FL-L Pasco County, Florida 2 2 1.1 0.071 FL-M Manatee County, Florida 2 2 1.3 0.143 FL-N Hillsborough County, Florida 2 2 1.3 0.071 FL-O Lake County, Florida 1 1 1.0 0.000 USA-Florida-overall 177 67 3.6 0.247 CHINA CHN-A Baise, Guangxi Province 3 2 1.1 0.071 CHN-B Guilin, Guangxi Province 3 3 1.4 0.